nucleotide_count: initial commit

cpp/nucleotide-count/CMakeLists.txt

@@ -0,0 +1,52 @@
+# Get the exercise name from the current directory
+get_filename_component(exercise ${CMAKE_CURRENT_SOURCE_DIR} NAME)
+
+# Basic CMake project
+cmake_minimum_required(VERSION 2.8.11)
+
+# Name the project after the exercise
+project(${exercise} CXX)
+
+# Locate Boost libraries: unit_test_framework, date_time and regex
+set(Boost_USE_STATIC_LIBS ON)
+set(Boost_USE_MULTITHREADED ON)
+set(Boost_USE_STATIC_RUNTIME OFF)
+find_package(Boost 1.55 REQUIRED COMPONENTS unit_test_framework date_time regex)
+
+# Enable C++11 features on gcc/clang
+if("${CMAKE_CXX_COMPILER_ID}" MATCHES "(GNU|Clang)")
+    set(CMAKE_CXX_FLAGS "-std=c++11")
+endif()
+
+# Configure to run all the tests?
+if(${EXERCISM_RUN_ALL_TESTS})
+    add_definitions(-DEXERCISM_RUN_ALL_TESTS)
+endif()
+
+# Get a source filename from the exercise name by replacing -'s with _'s
+string(REPLACE "-" "_" file ${exercise})
+
+# Implementation could be only a header
+if(EXISTS ${CMAKE_CURRENT_SOURCE_DIR}/${file}.cpp)
+    set(exercise_cpp ${file}.cpp)
+else()
+    set(exercise_cpp "")
+endif()
+
+# Build executable from sources and headers
+add_executable(${exercise} ${file}_test.cpp ${exercise_cpp} ${file}.h)
+
+# We need boost includes
+target_include_directories(${exercise} PRIVATE ${Boost_INCLUDE_DIRS})
+
+# We need boost libraries
+target_link_libraries(${exercise} ${Boost_LIBRARIES})
+
+# Tell MSVC not to warn us about unchecked iterators in debug builds
+if(${MSVC})
+    set_target_properties(${exercise} PROPERTIES
+        COMPILE_DEFINITIONS_DEBUG _SCL_SECURE_NO_WARNINGS)
+endif()
+
+# Run the tests on every build
+add_custom_command(TARGET ${exercise} POST_BUILD COMMAND ${exercise})

cpp/nucleotide-count/README.md

@@ -0,0 +1,63 @@
+# Nucleotide Count
+
+Given a DNA string, compute how many times each nucleotide occurs in the string.
+
+DNA is represented by an alphabet of the following symbols: 'A', 'C',
+'G', and 'T'.
+
+Each symbol represents a nucleotide, which is a fancy name for the
+particular molecules that happen to make up a large part of DNA.
+
+Shortest intro to biochemistry EVAR:
+
+- twigs are to birds nests as
+- nucleotides are to DNA and RNA as
+- amino acids are to proteins as
+- sugar is to starch as
+- oh crap lipids
+
+I'm not going to talk about lipids because they're crazy complex.
+
+So back to nucleotides.
+
+DNA contains four types of them: adenine (`A`), cytosine (`C`), guanine
+(`G`), and thymine (`T`).
+
+RNA contains a slightly different set of nucleotides, but we don't care
+about that for now.
+
+## Getting Started
+
+Make sure you have read the [getting started with C++](http://help.exercism.io/getting-started-with-cpp.html)
+page on the [exercism help site](http://help.exercism.io/).  This covers
+the basic information on setting up the development environment expected
+by the exercises.
+
+## Passing the Tests
+
+Get the first test compiling, linking and passing by following the [three
+rules of test-driven development](http://butunclebob.com/ArticleS.UncleBob.TheThreeRulesOfTdd).
+Create just enough structure by declaring namespaces, functions, classes,
+etc., to satisfy any compiler errors and get the test to fail.  Then write
+just enough code to get the test to pass.  Once you've done that,
+uncomment the next test by moving the following line past the next test.
+
+```C++
+#if defined(EXERCISM_RUN_ALL_TESTS)
+```
+
+This may result in compile errors as new constructs may be invoked that
+you haven't yet declared or defined.  Again, fix the compile errors minimally
+to get a failing test, then change the code minimally to pass the test,
+refactor your implementation for readability and expressiveness and then
+go on to the next test.
+
+Try to use standard C++11 facilities in preference to writing your own
+low-level algorithms or facilities by hand.  [CppReference](http://en.cppreference.com/)
+is a wiki reference to the C++ language and standard library.  If you
+are new to C++, but have programmed in C, beware of
+[C traps and pitfalls](http://www.slideshare.net/LegalizeAdulthood/c-traps-and-pitfalls-for-c-programmers).
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [view source](http://rosalind.info/problems/dna/)

cpp/nucleotide-count/nucleotide_count_test.cpp

@@ -0,0 +1,86 @@
+#include "nucleotide_count.h"
+#define BOOST_TEST_MAIN
+#include <boost/test/unit_test.hpp>
+#include <stdexcept>
+
+namespace boost
+{
+
+// teach Boost.Test how to print std::pair
+template <typename K, typename V>
+inline wrap_stringstream&
+operator<<(wrap_stringstream& wrapped, std::pair<const K, V> const& item)
+{
+    return wrapped << '<' << item.first << ',' << item.second << '>';
+}
+
+}
+
+BOOST_AUTO_TEST_CASE(has_no_nucleotides)
+{
+    const dna::counter dna("");
+    const std::map<char, int> expected{ {'A', 0}, {'T', 0}, {'C', 0}, {'G', 0} };
+
+    const auto actual = dna.nucleotide_counts();
+
+    BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), actual.begin(), actual.end());
+}
+
+#if defined(EXERCISM_RUN_ALL_TESTS)
+BOOST_AUTO_TEST_CASE(has_no_adenosine)
+{
+    const dna::counter dna("");
+
+    BOOST_REQUIRE_EQUAL(0, dna.count('A'));
+}
+
+BOOST_AUTO_TEST_CASE(repetitive_cytidine_gets_counts)
+{
+    const dna::counter dna("CCCCC");
+
+    BOOST_REQUIRE_EQUAL(5, dna.count('C'));
+}
+
+BOOST_AUTO_TEST_CASE(repetitive_sequence_has_only_guanosine)
+{
+    const dna::counter dna("GGGGGGGG");
+    const std::map<char, int> expected{ {'A', 0}, {'T', 0}, {'C', 0}, {'G', 8} };
+
+    const auto actual = dna.nucleotide_counts();
+
+    BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), actual.begin(), actual.end());
+}
+
+BOOST_AUTO_TEST_CASE(counts_only_thymidine)
+{
+    const dna::counter dna("GGGGTAACCCGG");
+
+    BOOST_REQUIRE_EQUAL(1, dna.count('T'));
+}
+
+BOOST_AUTO_TEST_CASE(counts_a_nucleotide_only_once)
+{
+    const dna::counter dna("GGTTGG");
+
+    dna.count('T');
+
+    BOOST_REQUIRE_EQUAL(2, dna.count('T'));
+}
+
+BOOST_AUTO_TEST_CASE(validates_nucleotides)
+{
+    const dna::counter dna("GGTTGG");
+
+    BOOST_REQUIRE_THROW(dna.count('X'), std::invalid_argument);
+}
+
+BOOST_AUTO_TEST_CASE(counts_all_nucleotides)
+{
+    const dna::counter dna("AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC");
+    std::map<char, int> expected{ {'A', 20}, {'T', 21}, {'G', 17}, {'C', 12} };
+
+    auto actual = dna.nucleotide_counts();
+
+    BOOST_REQUIRE_EQUAL_COLLECTIONS(expected.begin(), expected.end(), actual.begin(), actual.end());
+}
+#endif